Learning Objectives Sanger sequencing, also known as chain-termination sequencing, refers to a method of DNA sequencing developed by Frederick Sanger in 1977. This method is based on amplification of the DNA fragment to be sequenced by DNA polymerase and incorporation of modified nucleotides – specifically, dideoxynucleotides (ddNTPs). The classical chain-termination method requires a single-stranded DNA template, a DNA primer, a DNA polymerase, normal deoxynucleotidetriphosphates (dNTPs), and modified nucleotides (dideoxyNTPs) that terminate DNA strand elongation. These chain-terminating nucleotides lack a 3′-OH group required for the formation of a phosphodiester bond between two nucleotides, causing DNA polymerase to cease extension of DNA when a ddNTP is incorporated. The ddNTPs may be radioactively or fluorescently labelled for detection in automated sequencing machines.The DNA sample is divided into four separate sequencing reactions, containing all four of the standard deoxynucleotides (dATP, dGTP, dCTP and dTTP) and the DNA polymerase. To each reaction is added only one of the four dideoxynucleotides (ddATP, ddGTP, ddCTP, or ddTTP). Following rounds of template DNA extension from the bound primer, the resulting DNA fragments are heat denatured and separated by size using gel electrophoresis. This is frequently performed using a denaturing polyacrylamide-urea gel with each of the four reactions run in one of four individual lanes (lanes A, T, G, C). The DNA bands may then be visualized by autoradiography or UV light and the DNA sequence can be directly read off the X-ray film or gel image.  Technical variations of chain-termination sequencing include tagging with nucleotides containing radioactive phosphorus for radiolabelling, or using a primer labeled at the 5′ end with a fluorescent dye. Dye-primer sequencing facilitates reading in an optical system for faster and more economical analysis and automation. The later development by Leroy Hood and coworkers of fluorescently labeled ddNTPs and primers set the stage for automated, high-throughput DNA sequencing. Chain-termination methods have greatly simplified DNA sequencing. More recently, dye-terminator sequencing has been developed. Dye-terminator sequencing utilizes labelling of the chain terminator ddNTPs, which permits sequencing in a single reaction, rather than four reactions as in the labelled-primer method. In dye-terminator sequencing, each of the four dideoxynucleotide chain terminators is labelled with fluorescent dyes, each of which emit light at different wavelengths. Automated DNA-sequencing instruments (DNA sequencers) can sequence up to 384 DNA samples in a single batch (run) in up to 24 runs a day. DNA sequencers carry out capillary electrophoresis for size separation, detection and recording of dye fluorescence, and data output as fluorescent peak trace chromatograms. Automation has lead to the sequencing of entire genomes. Key Points
Key Terms
This page was written by Elizabeth Canfield '99 Sanger Method for DNA Sequencing DNA sequencing, first devised in 1975, has become a powerful technique in molecular biology, allowing analysis of genes at the nucleotide level. For this reason, this tool has been applied to many areas of research. For example, the polymerase chain reaction (PCR), a method which rapidly produces numerous copies of a desired piece of DNA, requires first knowing the flanking sequences of this piece. Another important use of DNA sequencing is identifying restriction sites in plasmids. Knowing these restriction sites is useful in cloning a foreign gene into the plasmid. Before the advent of DNA sequencing, molecular biologists had to sequence proteins directly; now amino acid sequences can be determined more easily by sequencing a piece of cDNA and finding an open reading frame. In eukaryotic gene expression, sequencing has allowed researchers to identify conserved sequence motifs and determine their importance in the promoter region. Furthermore, a molecular biologist can utilize sequencing to identify the site of a point mutation. These are only a few examples illustrating the way in which DNA sequencing has revolutionized molecular biology. Dideoxynucleotide sequencing represents only one method of sequencing DNA. It is commonly called Sanger sequencing since Sanger devised the method. This technique utilizes 2',3'-dideoxynucleotide triphospates (ddNTPs), molecules that differ from deoxynucleotides by the having a hydrogen atom attached to the 3' carbon rather than an OH group. (Figure 1). These molecules terminate DNA chain elongation because they cannot form a phosphodiester bond with the next deoxynucleotide. In order to perform the sequencing, one must first convert double stranded DNA into single stranded DNA. This can be done by denaturing the double stranded DNA with NaOH. A Sanger reaction consists of the following: a strand to be sequenced (one of the single strands which was denatured using NaOH), DNA primers (short pieces of DNA that are both complementary to the strand which is to be sequenced and radioactively labelled at the 5' end), a mixture of a particular ddNTP (such as ddATP) with its normal dNTP (dATP in this case), and the other three dNTPs (dCTP, dGTP, and dTTP). The concentration of ddATP should be 1% of the concentration of dATP. The logic behind this ratio is that after DNA polymerase is added, the polymerization will take place and will terminate whenever a ddATP is incorporated into the growing strand. If the ddATP is only 1% of the total concentration of dATP, a whole series of labeled strands will result (Figure 1). Note that the lengths of these strands are dependent on the location of the base relative to the 5' end. This reaction is performed four times using a different ddNTP for each reaction. When these reactions are completed, a polyacrylamide gel electrophoresis (PAGE) is performed. One reaction is loaded into one lane for a total of four lanes (Figure 2). The gel is transferred to a nitrocellulose filter and autoradiography is performed so that only the bands with the radioactive label on the 5' end will appear. In PAGE, the shortest fragments will migrate the farthest. Therefore, the bottom-most band indicates that its particular dideoxynucleotide was added first to the labeled primer. In Figure 2, for example, the band that migrated the farthest was in the ddATP reaction mixture. Therefore, ddATP must have been added first to the primer, and its complementary base, thymine, must have been the base present on the 3' end of the sequenced strand. One can continue reading in this fashion. Note in Figure 2 that if one reads the bases from the bottom up, one is reading the 5' to 3' sequence of the strand complementary to the sequenced strand. The sequenced strand can be read 5' to 3' by reading top to bottom the bases complementary to the those on the gel. Figure 1. This figure shows the structure of a dideoxynucleotide (notice the H atom attached to the 3' carbon). Also depicted in this figure are the ingredients for a Sanger reaction. Notice the different lengths of labeled strands produced in this reaction. Figure 2. This figure is a representation of an acrylamide sequencing gel. Notice that the sequence of the strand of DNA complementary to the sequenced strand is 5' to 3' ACGCCCGAGTAGCCCAGATT while the sequence of the sequenced strand, 5' to 3', is AATCTGGGCTACTCGGGCGT. This figure was taken with permission from <http://www.plattsburgh.edu/acadvp/artsci/biology/bio401/DNASeq.html> If you would like to learn about a variation of Sanger sequencing, click on cycle sequencing. Return to Bio111 Home PageReturn to Biology Dept. Main Page
© Copyright 2001 Department of Biology, Davidson College, Davidson, NC 28036 What is the importance of the ddNTP to dNTP ratio?The ratio of dNTP to ddNTP used is critical for the success of Sanger sequencing since it determines the distribution of DNA fragment lengths produced.
What happens if your ratio of ddNTPs to dNTPs is too high in a Sanger sequencing reaction?If you increased the ddNTP:dNTP ratio, you would get more sequence close to the primer, but make it more difficult to read sequence 200 to 300 nucleotides further down, because most of the synthetic products would have terminated earlier.}
What is the role of ddNTPs in DNA sequencing?DdNTP is used in Sanger sequencing, also known as chain-termination sequencing. In the Sanger sequencing method, DdNTP is used as a substance to stop the synthesis of DNA because of its lack of a free hydroxyl group needed for the replication of DNA. DdNTPs are often dyed to help in the DNA sequence analysis.
Why do ddNTPs lead to termination of DNA replication?Because DdNTPs have a hydrogen molecule (-H) instead of a hydroxyl group (-OH) attached to the 3'-C of its deoxyribose, it cannot bind to any incoming nucleotides. Therefore, addition of DdNTPs during DNA replication can be used to terminate the synthesis reaction.
|
What is the importance of the DdNTP to dNTP ratio in the chain termination DNA sequencing?
zusammenhängende Posts
Urheberrechte © © 2024 ihoctot Inc.
